# DNA Transition and Transversion Analysis Using Python

## Overview

This project performs DNA mutation analysis using Python by comparing two DNA sequences and identifying nucleotide substitutions.

The program calculates:

- Number of transitions
- Number of transversions
- Transition/Transversion ratio

Two different programming approaches are implemented to analyze DNA sequence mutations.

## Features

- Compare two DNA sequences
- Detect nucleotide substitutions
- Calculate transition mutations
- Calculate transversion mutations
- Calculate transition/transversion ratio
- Implement mutation analysis using two methods

## Technologies Used

- Python 3
- Bioinformatics Algorithms
- DNA Sequence Analysis
- Computational Biology

## Input DNA Sequences

### Sequence 1

GCAACGCACAACGAAAACCCTTAGGGACTGGATTATTTCGTGATCGTTGTAGTTATTGGAAGTACGGGCATCAACCCAGTT

### Sequence 2

TTATCTGACAAAGAAAGCCGTCAACGGCTGGATAATTTCGCGATCGTGCTGGTTACTGGCGGTACGAGTGTTCCTTTGGGT

## Bioinformatics Concepts

## 1. Transition Mutation

Transitions are substitutions between nucleotides of the same chemical group.

Purines:

A ↔ G

Pyrimidines:

C ↔ T

Examples:

A → G G → A C → T T → C

## 2. Transversion Mutation

Transversions are substitutions between different chemical groups.

Purine and pyrimidine changes:

A ↔ C A ↔ T G ↔ C G ↔ T

Examples:

A → C C → A A → T T → A G → C C → G G → T T → G

## Methods Implemented

## Method 1: Direct Condition Checking

The first approach checks every nucleotide position individually and identifies whether the mutation is a transition or transversion.

Example:

```python
if s1[i]=='A' and s2[i]=='G':
    transition += 1

Method 2: Optimized Comparison

The second approach stores each nucleotide pair into variables and compares possible mutation combinations.

Example:

first = s1[x]
second = s2[x]

This method improves code readability and reduces repetition.

Transition/Transversion Ratio

The ratio is calculated using:

Transition / Transversion

Formula:

Ratio = Number of Transitions / Number of Transversions

This ratio helps measure evolutionary changes between DNA sequences.

How to Run

1. Clone the repository:

git clone https://github.com/FathimaNufla2000/DNA-Transition-Transversion-Analysis-Python.git

2. Navigate to the project directory:

cd DNA-Transition-Transversion-Analysis-Python

3. Run the Python file:

python transition_transversion.py

Output

The program displays:

• Total number of transition mutations
• Total number of transversion mutations
• Transition/transversion ratio

Example output:

No of Transition : X

No of Transversion : Y

Ratio : Z

Learning Outcomes

Through this project, the following concepts are demonstrated:

• DNA sequence comparison
• Mutation classification
• Evolutionary sequence analysis
• Python conditional statements
• Loop-based sequence processing
• Basic bioinformatics programming

Applications

Transition and transversion analysis is useful in:

• Molecular evolution studies
• Genetic variation analysis
• Phylogenetic research
• Comparative genomics

Author

Fathima Nufla

GitHub: https://github.com/FathimaNufla2000

License

This project is developed for educational purposes and bioinformatics learning.